G	GTGGCCCCTGAGCGTCATCTGCCCCCACAGAGCGCT
G	Gauss
G	Gly
G	Glycine
G	Green
G	Guanosine
G	gain/loss
G	gate
G	gauge
G	gelatin
G	generator
G	generator175
G	glycerol
G	glycine
G	glyco
G	good
G	granular
G	granulocytic
G	graphene
G	green
G	groove
G	ground
G	group
G	group.
G	guanine
G	guanosine
G2H	Gateway 2Health
G3P	glyceraldehyde-3-phosphate
G6PD	glucose-6-phosphate dehydrogenase
GA	Gallic acid
GA	Genetic Algorithm
GA	Gestational Age
GA	Gibberellic acid
GA	Google Assistant®
GA	gallic acid
GA	gateway application
GA	genetic algorithm
GA	geographic atrophy
GA	glycine-alanine
GAA	Gate all around
GAA	General Authorized Access
GAA	Generic Authorized Access
GAA	gate all around
GAA	gate-all around
GAA	gate-all-around
GAB	Global Analog Beamforming
GABA	gamma-amino butyric acid
GAC	granular activated carbon
GAC	granulated activated carbon
GACS	Gravimetric Adsorption Capacity Scan
GAD	general anxiety disorder
GAD	generalized anxiety disorder
GAD	glutamic acid decarboxylase
GAGA	glycine-alanine-glycine-alanine
GAIT	GSM-ANSI Interoperability Team
GAL	Gamified Alphanumeric Labeler
GAL	Generic Array Logic
GALT	Gut-associated lymphoid tissue
GALV	Gibbon Ape Leukemia virus
GAM	generalized additive model
GAN	Generative Adversarial Network
GAN	Generative Adversarial Networks
GAN	Generative Adversial Network
GAN	Generic Access Network
GAN	Global Area Network
GAN	generative Adversarial Network
GAN	global area network
GAN	global area networks
GAP	GTPase activating proteins
GAP	GTPase-activating protein
GAP	Generic Access Profile
GAP	Global Average Pooling
GAP	Good Answers Protocol
GAP	generic access platform
GAS	Generic Advertisement Service
GAS	graphical audio station
GB	geo-block
GB	grain boundary
GBA	Generic Bootstrapping Architecture
GBAS	Ground Based Augmentation Systems
GBCI	Green Building Certification Institute
GBDT	Gradient Boosted Decision Trees
GBDT	Gradient Boosting Decision Tree
GBM	Gradient Boosting Machine
GBM	Gradient Boosting Machines
GBM	glomerular basement membrane
GBM	gradient boosted machine
GBP	Galactose-binding protein
GBP	Great British Pounds
GBR	Guaranteed Bit Rate
GBRT	Gradient Boosted Regression Trees
GBS	General Behavioral Score
GBS	Guillain-BarrE syndrome
GBS	grid-based segmentation
GBT	Graph-Based Transform
GBT	gradient boosting trees
GBT	gradient-boosted tree
GBT	graph-based transform
GC	Garbage Collection
GC	Gas Chromatography
GC	Germinal Center
GC	Granger causality
GC	gas chromatograph
GC	gas chromatography
GC	gastric cancer
GC	general counsel
GC	genome copy
GC	germinal center
GC	glycol chitosan
GC	group common
GC	group-common
GC	guide catheter
GCA	Global Cybersecurity Agenda
GCA	green coffee antioxidant
GCC	GNU CCompiler
GCC	Gulf Cooperation Council
GCC	ground calcium carbonate
GCD	Genomic Cleavage Detection
GCD	Granular corneal dystrophy
GCE	Google® Compute Engine
GCG	Genetics Computer Group
GCG	Genetics Computing Group
GCHO	GPEx® Chinese Hamster Ovary
GCI	Global Cybersecurity Index
GCI	global cell identity
GCI	graphical caregiver interface
GCIS	Global Clinical Impression Scale
GCIS	gas cluster ion sputter
GCL	guidance control loop
GCM	Genset Control Module
GCM	Gingival Crevice Model
GCMS	gas chromatograph mass spectrometry
GCMS	gas chromatography mass spectrometer
GCMS	gas chromatography-mass spectrometry
GCN	Graph Convolutional Network
GCN	granule cell neuronopathy
GCN	graph convolution network
GCN	graph convolution networks
GCN	graph convolutional network
GCP	Gene Catalog Proteins
GCP	Golay complementary pair
GCP	Good Clinical Practice
GCP	Google Cloud Platform
GCP	ground control point
GCR	Ground Coverage Ratio
GCR	glucose consumption rate
GCRA	Generic Cell Rate Algorithm
GCS	Glasgow coma scale
GCS	Ground Control System
GCS	generation control system
GCS	ground control system
GCSF	granulocyte colony stimulating factor
GCSF	granulocyte colony-stimulating factor
GCU	garbage collection unit
GD	Geomagnetic Disturbance
GD	gate driver
GD	gate-drain
GD	gingival display
GDC	Genomic Data Commons
GDC	gadolinium doped ceria
GDDR	Graphics Double Data Rate
GDF	geographic data files
GDF9	growth differentiation factor-9
GDI	GDP dissociation inhibitor
GDI	Graphics Device Interface
GDIC	gate driver integrated circuit
GDL	gas diffusion layer
GDMS	glow discharge mass spectrometry
GDNF	glial derived neurotrophic factor
GDNF	glial-derived nerve factor
GDO	Grid Dip Oscillator
GDP	Gross Domestic Product
GDPR	General Data Protection Regulation
GDPR	General Data Protection Regulations
GDR	Gradual Decoder Refresh
GDR	Gradual decoding refresh
GDR	giant dipole resonance
GDR	gradual decoding refresh
GDS	Global Distribution System
GDS	Graphic Data System
GDS	Graphic Design System
GDS	Graphical design system
GDS	glow discharge spectrometry
GDS	graphic database system
GDT	gas discharge tube
GE	Grid Elements
GE	gate electrode
GE	gene-end
GEBV	Genomic Estimated Breeding Value
GEM	General Electronic Module
GEM	Gradient Episodic Memory
GEM	general electronic module
GEO	Gallate enhanced oligomer
GEO	Gene Expression Omnibus
GEO	Gene Expression Omnnibus
GEO	Geostationary Earth Orbit
GEO	Geosynchronous Earth Orbit
GER	gearbox efficiency rating
GERAN	GSM EDGE Radio Access Network
GERD	Gastro Esophageal Reflux Disease
GERD	Gastro-esophageal reflux disease
GES	Golden Eye Stamp
GEWL	Goose Egg White Lysozyme
GF	Grant-free
GF	geometry-free
GF	germ free
GF	germ-free
GF	glass fiber
GFAP	Glial Fibrillary Acidic Protein
GFAP	Glial fibrillar acidic protein
GFAP	glial fibrillary acid protein
GFAP	glial fibrillary acidic protein
GFB	glomerular filtration barrier
GFBR	Guaranteed Flow Bit Rate
GFD	global file descriptor
GFDI	ground fault detection interrupters
GFDM	Generalized Frequency Division Multiplexing
GFIS	gas field ionization source
GFP	Green Florescent Protein
GFP	Green Fluorescence Protein
GFP	Green Fluorescent Protein
GFP	green fluorescence protein
GFP	green fluorescent protein
GFP	green fluorescent proteins
GFR	Glomerular filtration rate
GFRAL	GDNF Family Receptor Alpha Like
GFRAL	GDNF Family Receptor Alpha-Like
GFRP	glass fiber reinforced plastic
GFRP	glass fiber reinforced polymer
GFRP	glass fiber reinforced polymers
GFRP	glass fiber-reinforced plastics
GFRP	glass fibre reinforced plastic
GFRP	glass fibre reinforced polymer
GFRP	glass-fibre reinforced plastic
GFS	Global File System
GFSK	Gaussian Frequency-Shift Keying
GFT	generalized Fresnel transform
GG	grade group
GGA	generalized gradient approximation
GGB	ground germinated barley
GGBFS	Ground Granulated Blast Furnace Slag
GGG	glycine-glycine-glycine
GGGGS	Gly-Gly-Gly-Gly-Ser
GGGS	Gly-Gly-Gly-Ser
GGH	gas-gas heater
GGO	ground-glass opacities
GGRB	green-green-red-blue
GGSG	Gly-Gly-Ser-Gly
GGSN	Gateway GPRS Serving Node
GGSN	Gateway GPRS Support Node
GGSN	Gateway GPRS Support Node322
GGSN	gateway GPRS support node
GGT	Gamma-Glutamyl Transaminase
GGT	Gamma-glutamyl transferase
GGT	gamma glutamyl transpeptidase
GGT	gamma-glutamyl transferase
GGT	gamma-glutamyl transpeptidase
GH	Growth Hormone
GH	general health
GH	glycoside hydrolase
GH	growth hormone
GHE	Global Histogram Equalization
GHPP	good herbal processing practices
GHRH	growth hormone releasing hormone
GI	Guard Interval
GI	gastro-intestinal
GIA	Growth Inhibition Assays
GIAC	general inquiry access code
GICS	global industry classification standard
GIDL	Gate Induced Drain Leakage
GIDL	Gate-Induced Drain Leakage
GIDL	gate induced drain leakage
GIDL	gate-induced drain leakage
GIF	Graphic Interchange Format
GIF	Graphics Interchange Format
GILT	Glycosylation Independent Lysosomal Targeting
GIO	gallium indium oxide
GIP	Gastric Inhibitory Polypeptide
GIP	Gate In Panel
GIP	Gate-In-Panel
GIP	gastric inhibitory peptide
GIP	gate-in-panel
GIS	Geographic Information System
GIS	Geographic Information Systems
GIS	gas insulated switchgear
GIS	geographic information system
GITRL	glucocorticoid-induced TNF receptor ligand
GIXRD	Grazing Incidence X-ray Diffraction
GL	gate-level
GL	group leader
GLA	Glucopyranosyl lipid A
GLA	gamma linoleic acid
GLA	gamma-linoleic acid
GLA	glucopyranosyl lipid A
GLA	glucopyranosyl lipid adjuvant
GLB	Global Load Balancer
GLB	greatest lower bound
GLBA	Gramm-Leach-Bliley Act
GLBP	Gateway Load Balancing Protocol
GLEC	global logistics emissions council
GLEPS	guaranteed low end prize structures
GLEPS	guaranteed low-end prize structure
GLM	Generalized Linear Model
GLOH	gradient location-orientation histogram
GLP	Good Laboratory Practice
GLP	glucagon-like peptide
GLP1R	glucagon-like peptide-1receptor
GLS	global lookup system
GLSM	Geometric Least Squares Mean
GLUE	General Language Understanding Evaluation
GLV	Grating Light Valve
GLW	Gaming League Website
GM	General Motors
GM	Gifford-McMahon
GM	gingival margin
GM	granulocyte macrophage
GM	granulocyte-macrophage
GM	graphic manager
GM	grey matter
GM	group manager
GMA	Generic Multi-Access
GMAC	Galois message authentication code
GMAW	Gas metal arc welding
GMCH	graphics memory controller hub
GMCSF	granulocyte-macrophage colony stimulating factor
GMEM	Glasgow Minimum Essential Medium
GMF	geometric mean fluorescence
GMHA	glycidyl methacrylate hyaluronic acid
GMK	group master key
GMLC	Gateway Mobile Location Center
GMM	Gaussian Mixed Model
GMM	Gaussian Mixture Matrix
GMM	Gaussian Mixture Model
GMO	genetically modified organism
GMO	genetically modified organisms
GMP	Good Manufacturing Practice
GMP	Good Manufacturing Practices
GMP	Granulocyte Monocyte Progenitors
GMP	good manufacturing practice
GMP	good manufacturing practices
GMP	granulocyte-macrophage progenitors
GMPLS	Generalized Multi-Protocol Label Switching
GMPU	granular memory protection unit
GMR	Gigantic Magnetic Ratio
GMR	giant magneto resistance
GMR	giant magneto-resistive
GMS	globalization management system
GMSC	Gateway Mobile Switching Centre
GMSK	Gaussian minimum shift keying
GMSK	Gaussian minimum-shift keying
GMSL	Gigabit Multimedia Serial Link
GMT	Greenwich Mean Time
GNA	Glycol Nucleic Acid
GNA	glycerol nucleic acid
GNA	glycol nucleic acid
GNA	glycol nucleic acids
GNN	Graph Neural Networks
GNN	graph neural network
GNSS	Global Navigation Satellite System
GNSS	Global Navigation Satellite Systems
GNSS	Global navigational satellite systems
GNSS	global navigation satellite system
GNSS	global network satellite system
GNSS	global-navigation-satellite-system
GO	Gene Ontology
GO	Graphene Oxide
GO	Group Owner
GO	Gynecologic Oncologists
GO	gene ontology
GO	glucose oxidase
GO	graphene oxide
GOA	Gate On Array
GOB	GRID OF BEAMS
GOB	group of beams
GOB	group of blocks
GOC	gain offset clamp
GOF	glass optical fiber
GOF	group of frames
GOI	Group of Interest
GOI	Group-of-Interest
GOI	gene of interest
GOI	germanium-on-insulator
GOOSE	Generic Object Oriented Substation Event
GOP	Group Of Picture
GOP	Group of Pictures
GOP	group of picture
GOP	group of pictures
GOP	groups of pictures
GOR	Gained Output Ratio
GOS	Glasgow outcome score,
GOS	Global Osteitis Scores
GOT	glutamic-oxaloacetic transaminase
GP	Gaussian Process
GP	Gaussian Processes
GP	Gaussian process
GP	General Partner
GP	Grace Period
GP	Guaranteed Power
GP	Guard Period
GP	gear pump
GP	ground plane
GP	growth plate
GPA	grade point average
GPC	Gel Permeation Chromatography
GPC	General Processing Cluster
GPC	gel permeation chromatography
GPC	gel-permeation chromatography
GPC	general processing cluster
GPC	generalized predictive control
GPC	group party contracts
GPCP	general purpose computer processing
GPCR	G-protein coupled receptor
GPCR	GPROTEIN-COUPLED RECEPTOR
GPCR	GProtein Coupled Receptor
GPCR	Gprotein-coupled receptor
GPE	Generic Protocol Extension
GPE	Generic-Protocol-Extension
GPE	graphics processing engine
GPF	Gasoline Particulate Filter
GPFS	Global Parallel File System
GPGPU	general purpose graphics processing unit
GPGPU	general-purpose graphics processing unit
GPGPU	general-purpose graphics processor unit
GPI	general purpose interface
GPI	generic product identifier
GPI	granule protection information
GPIO	General Programmable Input Output
GPIO	general purpose input output
GPIO	general-purpose input-output
GPIP	ground plane intersection point
GPM	gallons-per-minute
GPN	greater palatine nerve208
GPO	Get Processing Options
GPO	Group Policy Objects
GPO	Group Policy Option
GPO	general purpose output
GPO	get processing options
GPON	Gigabit Passive Optical Network
GPP	Generation Partnership Project
GPR	Gaussian Process Regression
GPR	gas phase reactors
GPRS	GSM/General Packet Radio Service
GPRS	General Packet Radio Service
GPRS	General Packet Radio Services
GPRS	general packet radio service
GPS	Glasgow Prognostic Score
GPS	Global Position System
GPS	Global Positioning Satellite
GPS	Global Positioning System
GPS	Global Positioning Systems
GPS	geographical positioning system
GPS	geometry parameter set
GPS	global position sensor
GPS	global positioning satellite
GPS	global positioning sensor
GPS	global positioning system
GPS	global positions system
GPS	global-positioning-satellite
GPS	ground positioning satellite
GPS	ground-positioning system
GPSDR	general-purpose software-defined radio
GPSI	generic public subscription identifier
GPT	granule protection table
GPT1	glutamate-pyruvate transaminase 1
GPU	General Processing Unit
GPU	Graphic Processing Unit
GPU	Graphic Processor Unit
GPU	Graphical Processing Unit
GPU	Graphical Processing Units
GPU	Graphics Processing Unit
GPU	Graphics Processing Units
GPU	Graphics Processor Unit
GPU	Graphics processing unit
GPU	graphic process unit
GPU	graphic processing unit
GPU	graphic processing units
GPU	graphic processing units'
GPU	graphical processing unit
GPU	graphical processor unit
GPU	graphics processing unit
GPU	graphics processing units
GPU	graphics processor unit
GPU	graphics-processing unit
GPU	graphs processing unit
GPV	general planetary vehicle
GPWS	ground proximity warning system
GQN	Generative Query Networks
GR	Geographical Redundancy
GR	Gingival Recession
GR	Green River
GR	gear ratio
GR	glucocorticoid receptor
GR	glutathione receptor
GR	glutathione reductase
GRA	gel retardation assay
GRA	gel-retardation assay
GRA	glucagon receptor antagonists
GRA	gradal random access
GRA	gradual random access
GRAN	GSM Radio Access Network
GRAS	Generally Recognized As Safe
GRAS	Generally-Recognized-as-Safe
GRAS	generally recognized as safe
GRAS	generally regarded as safe
GRBF	generalized radial basis functions
GRC	gray rami communicans
GRE	Generic Route Encapsulation
GRE	Generic Routing Encapsulation
GRE	glucorticoid responsive element
GRF	ground-reaction-force
GRH	Global Route Header
GRH	Global Routing Header
GRI	Gas Research Institute
GRMD	golden retriever muscular dystrophy
GRN	Gene regulatory network
GRP	Gastrin Releasing Peptide
GRP	Gross Rating Points
GRP	gastrin-releasing peptide
GRP	gastrin-releasing peptides
GRP	glass-reinforced-plastic
GRPR	Gastrin-releasing peptide receptor
GRS	Global Recycled Standard
GRT	generalized Radon transform
GRTA	gas rapid thermal annealing
GRU	Gated Recurrent Unit
GRU	Gated Recurrent Units
GRU	gate recurrent unit
GRU	gated recurrent units
GS	Gait speed
GS	Generic stream
GS	Genomic Selection
GS	Glutamine Synthetase
GS	Gsegment
GS	gas source
GS	gate-source
GS	global shutter
GS	glutamine synthases
GSB	Granular sludge bed
GSC	Glioma Stem Cell
GSCN	Global Synchronization Channel Number
GSD	General Station Description
GSD	Geometric Standard Deviation
GSD	Ground sampling distance
GSD	geometric standard deviations
GSDL	Global Scheduling Description Language
GSE	Ground Support Equipment
GSEA	Gene Set Enrichment Analysis
GSEA	gene-set enrichment analysis
GSG	Ground-Signal-Ground
GSG	glycosylated steviol glycoside
GSI	Gel Swelling Index
GSIS	Glucose-Stimulated Insulin Secretion
GSIS	glucose stimulated insulin secretion
GSK	Glucogen Synthase Kinase
GSK	glycogen synthase kinase
GSK3Β	glycogen synthase kinase 3Β
GSM	Genome-scale Model
GSM	Global Systeme Mobile
GSM	Groupe SpEcial Mobile
GSM	gear shift module
GSM	gear shifter module
GSM	grip-strength meter
GSMA	Groupe Speciale Mobile Association
GSN	Global Sequence Number
GSP	graphics system processors
GSR	Galvanic Skin Response
GSRM	global session resource manager
GSS	generation-shedding system
GSSA	Golden Section search algorithm
GSSM	gene site saturated mutagenesis
GST	Galileo System Time
GST	Glutathione S-transferase
GST	glutathinone-S-transferase
GST	glutathione S-transferase
GST	glutathione Stransferase
GST	glutathione-S-transferase
GSZ	gadolinia stabilized zirconias
GT	Giga Ton
GT	Global Title
GT	Greater Trochanter
GT	graph theory
GT	greater-than
GT	ground truth
GTA	glycerol teichoic acid
GTC	Generic Token Card
GTC	green tea catechins
GTIN	Global Trade Item Number
GTK	group temporal key
GTL	Guide Template Language
GTL	Gunning transceiver logic
GTMS	glass-to metal seal
GTMS	glass-to-metal seal
GTO	Geosynchronous Transfer Orbits
GTO	gallium tin oxide
GTP	GPRS Tunneling Protocol
GTP	GPRS Tunnelling Protocol
GTP	GPRS tunneling protocol
GTR	ground tire rubber
GTS	Go To Sleep
GTS	Go-To-Sleep
GTS	Guaranteed Time Slots
GTT	Glucose tolerance tests
GTT	global transaction table
GTU	gated tanh units
GU	Glucose Units
GUI	Graphic User Interface
GUI	Graphical User Interface
GUI	Graphical User Interfaces
GUI	graphic user interface
GUI	graphical user interface
GUI	graphical-user interface
GUTI	Globally Unique Temporary Identifier
GUTI	Globally Unique Temporary Identity
GUV	giant unilamellar vesicles
GV	Gentian Violet
GV	granulosis viruses
GVD	geometry video data
GVF	gas void fraction
GVHD	Graft Versus Host Disease
GVHD	Graft vs. Host disease
GVHD	Graft-Versus-Host Disease
GVHD	graft versus host disease
GVHD	graft vs. host disease
GVHD	graft-versus-host disease
GVHD	graft-versus-host-disease
GVM	gross vehicle mass
GVNS	Global Variable Name System
GVS	Gravimetric Vapour Sorption
GVW	Gross Vehicle Weight
GVWR	gross vehicle weight rating
GW	gate width
GWA	genome-wide association
GWAS	Genome Wide Association Studies
GWAS	Genome-wide association studies
GWP	Global Warming Potential
GZO	gallium zinc oxide