G GTGGCCCCTGAGCGTCATCTGCCCCCACAGAGCGCT G Gauss G Gly G Glycine G Green G Guanosine G gain/loss G gate G gauge G gelatin G generator G generator175 G glycerol G glycine G glyco G good G granular G granulocytic G graphene G green G groove G ground G group G group. G guanine G guanosine G2H Gateway 2Health G3P glyceraldehyde-3-phosphate G6PD glucose-6-phosphate dehydrogenase GA Gallic acid GA Genetic Algorithm GA Gestational Age GA Gibberellic acid GA Google Assistant® GA gallic acid GA gateway application GA genetic algorithm GA geographic atrophy GA glycine-alanine GAA Gate all around GAA General Authorized Access GAA Generic Authorized Access GAA gate all around GAA gate-all around GAA gate-all-around GAB Global Analog Beamforming GABA gamma-amino butyric acid GAC granular activated carbon GAC granulated activated carbon GACS Gravimetric Adsorption Capacity Scan GAD general anxiety disorder GAD generalized anxiety disorder GAD glutamic acid decarboxylase GAGA glycine-alanine-glycine-alanine GAIT GSM-ANSI Interoperability Team GAL Gamified Alphanumeric Labeler GAL Generic Array Logic GALT Gut-associated lymphoid tissue GALV Gibbon Ape Leukemia virus GAM generalized additive model GAN Generative Adversarial Network GAN Generative Adversarial Networks GAN Generative Adversial Network GAN Generic Access Network GAN Global Area Network GAN generative Adversarial Network GAN global area network GAN global area networks GAP GTPase activating proteins GAP GTPase-activating protein GAP Generic Access Profile GAP Global Average Pooling GAP Good Answers Protocol GAP generic access platform GAS Generic Advertisement Service GAS graphical audio station GB geo-block GB grain boundary GBA Generic Bootstrapping Architecture GBAS Ground Based Augmentation Systems GBCI Green Building Certification Institute GBDT Gradient Boosted Decision Trees GBDT Gradient Boosting Decision Tree GBM Gradient Boosting Machine GBM Gradient Boosting Machines GBM glomerular basement membrane GBM gradient boosted machine GBP Galactose-binding protein GBP Great British Pounds GBR Guaranteed Bit Rate GBRT Gradient Boosted Regression Trees GBS General Behavioral Score GBS Guillain-BarrE syndrome GBS grid-based segmentation GBT Graph-Based Transform GBT gradient boosting trees GBT gradient-boosted tree GBT graph-based transform GC Garbage Collection GC Gas Chromatography GC Germinal Center GC Granger causality GC gas chromatograph GC gas chromatography GC gastric cancer GC general counsel GC genome copy GC germinal center GC glycol chitosan GC group common GC group-common GC guide catheter GCA Global Cybersecurity Agenda GCA green coffee antioxidant GCC GNU CCompiler GCC Gulf Cooperation Council GCC ground calcium carbonate GCD Genomic Cleavage Detection GCD Granular corneal dystrophy GCE Google® Compute Engine GCG Genetics Computer Group GCG Genetics Computing Group GCHO GPEx® Chinese Hamster Ovary GCI Global Cybersecurity Index GCI global cell identity GCI graphical caregiver interface GCIS Global Clinical Impression Scale GCIS gas cluster ion sputter GCL guidance control loop GCM Genset Control Module GCM Gingival Crevice Model GCMS gas chromatograph mass spectrometry GCMS gas chromatography mass spectrometer GCMS gas chromatography-mass spectrometry GCN Graph Convolutional Network GCN granule cell neuronopathy GCN graph convolution network GCN graph convolution networks GCN graph convolutional network GCP Gene Catalog Proteins GCP Golay complementary pair GCP Good Clinical Practice GCP Google Cloud Platform GCP ground control point GCR Ground Coverage Ratio GCR glucose consumption rate GCRA Generic Cell Rate Algorithm GCS Glasgow coma scale GCS Ground Control System GCS generation control system GCS ground control system GCSF granulocyte colony stimulating factor GCSF granulocyte colony-stimulating factor GCU garbage collection unit GD Geomagnetic Disturbance GD gate driver GD gate-drain GD gingival display GDC Genomic Data Commons GDC gadolinium doped ceria GDDR Graphics Double Data Rate GDF geographic data files GDF9 growth differentiation factor-9 GDI GDP dissociation inhibitor GDI Graphics Device Interface GDIC gate driver integrated circuit GDL gas diffusion layer GDMS glow discharge mass spectrometry GDNF glial derived neurotrophic factor GDNF glial-derived nerve factor GDO Grid Dip Oscillator GDP Gross Domestic Product GDPR General Data Protection Regulation GDPR General Data Protection Regulations GDR Gradual Decoder Refresh GDR Gradual decoding refresh GDR giant dipole resonance GDR gradual decoding refresh GDS Global Distribution System GDS Graphic Data System GDS Graphic Design System GDS Graphical design system GDS glow discharge spectrometry GDS graphic database system GDT gas discharge tube GE Grid Elements GE gate electrode GE gene-end GEBV Genomic Estimated Breeding Value GEM General Electronic Module GEM Gradient Episodic Memory GEM general electronic module GEO Gallate enhanced oligomer GEO Gene Expression Omnibus GEO Gene Expression Omnnibus GEO Geostationary Earth Orbit GEO Geosynchronous Earth Orbit GER gearbox efficiency rating GERAN GSM EDGE Radio Access Network GERD Gastro Esophageal Reflux Disease GERD Gastro-esophageal reflux disease GES Golden Eye Stamp GEWL Goose Egg White Lysozyme GF Grant-free GF geometry-free GF germ free GF germ-free GF glass fiber GFAP Glial Fibrillary Acidic Protein GFAP Glial fibrillar acidic protein GFAP glial fibrillary acid protein GFAP glial fibrillary acidic protein GFB glomerular filtration barrier GFBR Guaranteed Flow Bit Rate GFD global file descriptor GFDI ground fault detection interrupters GFDM Generalized Frequency Division Multiplexing GFIS gas field ionization source GFP Green Florescent Protein GFP Green Fluorescence Protein GFP Green Fluorescent Protein GFP green fluorescence protein GFP green fluorescent protein GFP green fluorescent proteins GFR Glomerular filtration rate GFRAL GDNF Family Receptor Alpha Like GFRAL GDNF Family Receptor Alpha-Like GFRP glass fiber reinforced plastic GFRP glass fiber reinforced polymer GFRP glass fiber reinforced polymers GFRP glass fiber-reinforced plastics GFRP glass fibre reinforced plastic GFRP glass fibre reinforced polymer GFRP glass-fibre reinforced plastic GFS Global File System GFSK Gaussian Frequency-Shift Keying GFT generalized Fresnel transform GG grade group GGA generalized gradient approximation GGB ground germinated barley GGBFS Ground Granulated Blast Furnace Slag GGG glycine-glycine-glycine GGGGS Gly-Gly-Gly-Gly-Ser GGGS Gly-Gly-Gly-Ser GGH gas-gas heater GGO ground-glass opacities GGRB green-green-red-blue GGSG Gly-Gly-Ser-Gly GGSN Gateway GPRS Serving Node GGSN Gateway GPRS Support Node GGSN Gateway GPRS Support Node322 GGSN gateway GPRS support node GGT Gamma-Glutamyl Transaminase GGT Gamma-glutamyl transferase GGT gamma glutamyl transpeptidase GGT gamma-glutamyl transferase GGT gamma-glutamyl transpeptidase GH Growth Hormone GH general health GH glycoside hydrolase GH growth hormone GHE Global Histogram Equalization GHPP good herbal processing practices GHRH growth hormone releasing hormone GI Guard Interval GI gastro-intestinal GIA Growth Inhibition Assays GIAC general inquiry access code GICS global industry classification standard GIDL Gate Induced Drain Leakage GIDL Gate-Induced Drain Leakage GIDL gate induced drain leakage GIDL gate-induced drain leakage GIF Graphic Interchange Format GIF Graphics Interchange Format GILT Glycosylation Independent Lysosomal Targeting GIO gallium indium oxide GIP Gastric Inhibitory Polypeptide GIP Gate In Panel GIP Gate-In-Panel GIP gastric inhibitory peptide GIP gate-in-panel GIS Geographic Information System GIS Geographic Information Systems GIS gas insulated switchgear GIS geographic information system GITRL glucocorticoid-induced TNF receptor ligand GIXRD Grazing Incidence X-ray Diffraction GL gate-level GL group leader GLA Glucopyranosyl lipid A GLA gamma linoleic acid GLA gamma-linoleic acid GLA glucopyranosyl lipid A GLA glucopyranosyl lipid adjuvant GLB Global Load Balancer GLB greatest lower bound GLBA Gramm-Leach-Bliley Act GLBP Gateway Load Balancing Protocol GLEC global logistics emissions council GLEPS guaranteed low end prize structures GLEPS guaranteed low-end prize structure GLM Generalized Linear Model GLOH gradient location-orientation histogram GLP Good Laboratory Practice GLP glucagon-like peptide GLP1R glucagon-like peptide-1receptor GLS global lookup system GLSM Geometric Least Squares Mean GLUE General Language Understanding Evaluation GLV Grating Light Valve GLW Gaming League Website GM General Motors GM Gifford-McMahon GM gingival margin GM granulocyte macrophage GM granulocyte-macrophage GM graphic manager GM grey matter GM group manager GMA Generic Multi-Access GMAC Galois message authentication code GMAW Gas metal arc welding GMCH graphics memory controller hub GMCSF granulocyte-macrophage colony stimulating factor GMEM Glasgow Minimum Essential Medium GMF geometric mean fluorescence GMHA glycidyl methacrylate hyaluronic acid GMK group master key GMLC Gateway Mobile Location Center GMM Gaussian Mixed Model GMM Gaussian Mixture Matrix GMM Gaussian Mixture Model GMO genetically modified organism GMO genetically modified organisms GMP Good Manufacturing Practice GMP Good Manufacturing Practices GMP Granulocyte Monocyte Progenitors GMP good manufacturing practice GMP good manufacturing practices GMP granulocyte-macrophage progenitors GMPLS Generalized Multi-Protocol Label Switching GMPU granular memory protection unit GMR Gigantic Magnetic Ratio GMR giant magneto resistance GMR giant magneto-resistive GMS globalization management system GMSC Gateway Mobile Switching Centre GMSK Gaussian minimum shift keying GMSK Gaussian minimum-shift keying GMSL Gigabit Multimedia Serial Link GMT Greenwich Mean Time GNA Glycol Nucleic Acid GNA glycerol nucleic acid GNA glycol nucleic acid GNA glycol nucleic acids GNN Graph Neural Networks GNN graph neural network GNSS Global Navigation Satellite System GNSS Global Navigation Satellite Systems GNSS Global navigational satellite systems GNSS global navigation satellite system GNSS global network satellite system GNSS global-navigation-satellite-system GO Gene Ontology GO Graphene Oxide GO Group Owner GO Gynecologic Oncologists GO gene ontology GO glucose oxidase GO graphene oxide GOA Gate On Array GOB GRID OF BEAMS GOB group of beams GOB group of blocks GOC gain offset clamp GOF glass optical fiber GOF group of frames GOI Group of Interest GOI Group-of-Interest GOI gene of interest GOI germanium-on-insulator GOOSE Generic Object Oriented Substation Event GOP Group Of Picture GOP Group of Pictures GOP group of picture GOP group of pictures GOP groups of pictures GOR Gained Output Ratio GOS Glasgow outcome score, GOS Global Osteitis Scores GOT glutamic-oxaloacetic transaminase GP Gaussian Process GP Gaussian Processes GP Gaussian process GP General Partner GP Grace Period GP Guaranteed Power GP Guard Period GP gear pump GP ground plane GP growth plate GPA grade point average GPC Gel Permeation Chromatography GPC General Processing Cluster GPC gel permeation chromatography GPC gel-permeation chromatography GPC general processing cluster GPC generalized predictive control GPC group party contracts GPCP general purpose computer processing GPCR G-protein coupled receptor GPCR GPROTEIN-COUPLED RECEPTOR GPCR GProtein Coupled Receptor GPCR Gprotein-coupled receptor GPE Generic Protocol Extension GPE Generic-Protocol-Extension GPE graphics processing engine GPF Gasoline Particulate Filter GPFS Global Parallel File System GPGPU general purpose graphics processing unit GPGPU general-purpose graphics processing unit GPGPU general-purpose graphics processor unit GPI general purpose interface GPI generic product identifier GPI granule protection information GPIO General Programmable Input Output GPIO general purpose input output GPIO general-purpose input-output GPIP ground plane intersection point GPM gallons-per-minute GPN greater palatine nerve208 GPO Get Processing Options GPO Group Policy Objects GPO Group Policy Option GPO general purpose output GPO get processing options GPON Gigabit Passive Optical Network GPP Generation Partnership Project GPR Gaussian Process Regression GPR gas phase reactors GPRS GSM/General Packet Radio Service GPRS General Packet Radio Service GPRS General Packet Radio Services GPRS general packet radio service GPS Glasgow Prognostic Score GPS Global Position System GPS Global Positioning Satellite GPS Global Positioning System GPS Global Positioning Systems GPS geographical positioning system GPS geometry parameter set GPS global position sensor GPS global positioning satellite GPS global positioning sensor GPS global positioning system GPS global positions system GPS global-positioning-satellite GPS ground positioning satellite GPS ground-positioning system GPSDR general-purpose software-defined radio GPSI generic public subscription identifier GPT granule protection table GPT1 glutamate-pyruvate transaminase 1 GPU General Processing Unit GPU Graphic Processing Unit GPU Graphic Processor Unit GPU Graphical Processing Unit GPU Graphical Processing Units GPU Graphics Processing Unit GPU Graphics Processing Units GPU Graphics Processor Unit GPU Graphics processing unit GPU graphic process unit GPU graphic processing unit GPU graphic processing units GPU graphic processing units' GPU graphical processing unit GPU graphical processor unit GPU graphics processing unit GPU graphics processing units GPU graphics processor unit GPU graphics-processing unit GPU graphs processing unit GPV general planetary vehicle GPWS ground proximity warning system GQN Generative Query Networks GR Geographical Redundancy GR Gingival Recession GR Green River GR gear ratio GR glucocorticoid receptor GR glutathione receptor GR glutathione reductase GRA gel retardation assay GRA gel-retardation assay GRA glucagon receptor antagonists GRA gradal random access GRA gradual random access GRAN GSM Radio Access Network GRAS Generally Recognized As Safe GRAS Generally-Recognized-as-Safe GRAS generally recognized as safe GRAS generally regarded as safe GRBF generalized radial basis functions GRC gray rami communicans GRE Generic Route Encapsulation GRE Generic Routing Encapsulation GRE glucorticoid responsive element GRF ground-reaction-force GRH Global Route Header GRH Global Routing Header GRI Gas Research Institute GRMD golden retriever muscular dystrophy GRN Gene regulatory network GRP Gastrin Releasing Peptide GRP Gross Rating Points GRP gastrin-releasing peptide GRP gastrin-releasing peptides GRP glass-reinforced-plastic GRPR Gastrin-releasing peptide receptor GRS Global Recycled Standard GRT generalized Radon transform GRTA gas rapid thermal annealing GRU Gated Recurrent Unit GRU Gated Recurrent Units GRU gate recurrent unit GRU gated recurrent units GS Gait speed GS Generic stream GS Genomic Selection GS Glutamine Synthetase GS Gsegment GS gas source GS gate-source GS global shutter GS glutamine synthases GSB Granular sludge bed GSC Glioma Stem Cell GSCN Global Synchronization Channel Number GSD General Station Description GSD Geometric Standard Deviation GSD Ground sampling distance GSD geometric standard deviations GSDL Global Scheduling Description Language GSE Ground Support Equipment GSEA Gene Set Enrichment Analysis GSEA gene-set enrichment analysis GSG Ground-Signal-Ground GSG glycosylated steviol glycoside GSI Gel Swelling Index GSIS Glucose-Stimulated Insulin Secretion GSIS glucose stimulated insulin secretion GSK Glucogen Synthase Kinase GSK glycogen synthase kinase GSK3Β glycogen synthase kinase 3Β GSM Genome-scale Model GSM Global Systeme Mobile GSM Groupe SpEcial Mobile GSM gear shift module GSM gear shifter module GSM grip-strength meter GSMA Groupe Speciale Mobile Association GSN Global Sequence Number GSP graphics system processors GSR Galvanic Skin Response GSRM global session resource manager GSS generation-shedding system GSSA Golden Section search algorithm GSSM gene site saturated mutagenesis GST Galileo System Time GST Glutathione S-transferase GST glutathinone-S-transferase GST glutathione S-transferase GST glutathione Stransferase GST glutathione-S-transferase GSZ gadolinia stabilized zirconias GT Giga Ton GT Global Title GT Greater Trochanter GT graph theory GT greater-than GT ground truth GTA glycerol teichoic acid GTC Generic Token Card GTC green tea catechins GTIN Global Trade Item Number GTK group temporal key GTL Guide Template Language GTL Gunning transceiver logic GTMS glass-to metal seal GTMS glass-to-metal seal GTO Geosynchronous Transfer Orbits GTO gallium tin oxide GTP GPRS Tunneling Protocol GTP GPRS Tunnelling Protocol GTP GPRS tunneling protocol GTR ground tire rubber GTS Go To Sleep GTS Go-To-Sleep GTS Guaranteed Time Slots GTT Glucose tolerance tests GTT global transaction table GTU gated tanh units GU Glucose Units GUI Graphic User Interface GUI Graphical User Interface GUI Graphical User Interfaces GUI graphic user interface GUI graphical user interface GUI graphical-user interface GUTI Globally Unique Temporary Identifier GUTI Globally Unique Temporary Identity GUV giant unilamellar vesicles GV Gentian Violet GV granulosis viruses GVD geometry video data GVF gas void fraction GVHD Graft Versus Host Disease GVHD Graft vs. Host disease GVHD Graft-Versus-Host Disease GVHD graft versus host disease GVHD graft vs. host disease GVHD graft-versus-host disease GVHD graft-versus-host-disease GVM gross vehicle mass GVNS Global Variable Name System GVS Gravimetric Vapour Sorption GVW Gross Vehicle Weight GVWR gross vehicle weight rating GW gate width GWA genome-wide association GWAS Genome Wide Association Studies GWAS Genome-wide association studies GWP Global Warming Potential GZO gallium zinc oxide